Please wait a minute...
TMR Modern Herbal Medicine  2018, Vol. 1 Issue (4): 189-197    DOI: 10.12032/TMRmhm2017A35
Original Article     
Effect of TongFengNing Decoction on Uric Acid Levels and Xanthine Oxidase Activity in Hyperuricemia Rats
Wang Jian-hui1, Guo Jie-mei2, Li Bao-lin1, Teng Fang-zhou1, Zhu Ya-ju1, Lin Jian-ping3, Xiao Yan1, Mao Xiao1, Huang Lu-lu1, Su You-xin1,2,*()
1 Fujian University of Traditional Chinese Medicine, Fujian, China.
2 Fujian Health College, Fujian, China.
3 The Affiliated Rehabilitation Hospital of Fujian University of Traditional Chinese Medicine, Fujian, China.
Download: HTML     PDF(1926KB)
Export: BibTeX | EndNote (RIS)      

Objective: To observe the effect of TongFengNing Decoction (TD) on uric acid levels, xanthine oxidase (XOD) activity, and XOD mRNA expression of hyperuricemia (HUA) model rats. Methods: 90 rats were randomly divided into 6 groups (n=15), and the HUA model in all groups except the blank group was established by administering hypoxanthine (HX) by gavage and injecting potassium oxonate (OAPS) intraperitoneally. Rats in all TD groups and allopurinol group were administered multiple doses of TD and a single dose of allopurinol by gavage twice daily for 21 days, while the blank group and the model group were administered normal saline. On the 7th, 14th, and 21st days of drug intervention, serum uric acid (SUA), urine uric acid (UUA), intestinal uric acid (IUA), as well as XOD activity and mRNA expression in the liver and small intestine were measured in randomly selected 5 rats of each group. Results: On the 14th and 21st days of intervention, all TD dose groups and the allopurinol group showed decreased SUA and IUA levels, increased UUA levels, as well as decreased XOD activity and mRNA expression in the liver and small intestine, compared with the model group (P < 0.05). The low- and high-dose TD group and the allopurinol group showed increased SUA and IUA levels, as well as XOD activity and mRNA expression in the liver and small intestine, and decreased UUA levels, compared with the moderate-dose TD group (P<0.05). Upon extending the drug intervention time of each TD dose group, SUA and IUA levels, XOD activity, and XOD mRNA expression in the liver and small intestine decreased and UUA levels increased (P < 0.05). Conclusion: TD reduces SUA levels in HUA model rats, which promotes uric acid excretion and inhibits XOD activity and XOD mRNA expression to reduce uric acid production. The reduction in uric acid level by the intermediate dose of TD was better than that by allopurinol and the low and high doses of TD.

Highlights

The effect of TongFengNing Decoction (TD) on xanthine oxidase (XOD) activity and mRNA expression in the liver and small intestine of a hyperuricemia (HUA) rat model was explored as the possible mechanism of action for reducing serum uric acid (SUA). The experimental results show that TD reduces SUA levels in HUA model rats by promoting uric acid excretion and inhibiting XOD activity and mRNA expression. These results demonstrate the probable mechanism by which TD lowers uric acid, highlight its clinical application, and reflect the therapeutic advantage of using traditional Chinese medicine.



Key wordsTongFengNing      Hyperuricemia      Xanthine oxidase      Uric acid      Traditional Chinese medicine     
Published: 25 October 2018
Fund:  This work supported by the National Natural Science Foundation of China (NO.81473495).
Corresponding Authors: Su You-xin     E-mail: suyouxin777@hotmail.com
About author: # Both authors contributed equally to this work.
Cite this article:

Wang Jian-hui, Guo Jie-mei, Li Bao-lin, Teng Fang-zhou, Zhu Ya-ju, Lin Jian-ping, Xiao Yan, Mao Xiao, Huang Lu-lu, Su You-xin. Effect of TongFengNing Decoction on Uric Acid Levels and Xanthine Oxidase Activity in Hyperuricemia Rats. TMR Modern Herbal Medicine, 2018, 1(4): 189-197. doi: 10.12032/TMRmhm2017A35

URL:

https://www.tmrjournals.com/mhm/EN/10.12032/TMRmhm2017A35     OR     https://www.tmrjournals.com/mhm/EN/Y2018/V1/I4/189

Name Primer sequences Amplification products
XOD F: 5TCTTCCTGGCTGCTTCTATCTT3
R: 5TGTTCTGTGGTATGTTCCTCCT3
284 bp
GAPDH F: 5ACGGCAAGTTCAACGGCACAG3
R: 5GAAGACGCCAGTAGACTCCACGAC3
124 bp
Table 1 Primer sequences
Groups 7 d 14 d 21 d
1 115.12±19.30 115.00±21.53 114.20±17.56
2 409.63±17.98 474.30±20.01 547.16±20.66
3 397.14±11.97 330.75±10.79★▼■ 260.19±10.88★▼■
4 395.69±13.88 250.90±3.75★■ 150.58±11.02★■
5 366.78±20.17 304.38±9.01★▼■ 185.23±11.15★▼■
6 275.94±11.98★▼ 271.81±4.33★▼ 250.06±9.11★▼
Table 2 Comparison of SUA in each group rats over time ($\bar{x}$±s, n=5, mmol/L)
Groups 7 d 14 d 21 d
1 1326.40±53.68 1371.59±32.57 1320.55±29.46
2 1324.10±38.86 1333.18±38.86 1229.2±44.46
3 1345.38±86.52 1629.85±76.26★▼■ 1703.72±88.19★▼
4 1355.67±89.25 1922.37±79.09★■ 1992.20±70.58
5 1341.50±62.45 1792.20±52.86★▼■ 1863.45±46.27★▼
6 1289.76±56.46 1359.98±59.28 1307.18±73.55
Table 3 Comparison of UUA in each group rats over time ($\bar{x}$±s, n=5, mmol/L)
Groups 7 d 14 d 21 d
1 28.97±7.41 26.92±3.32 27.89±5.28
2 70.29±8.69 87.29±10.44 99.38±10.78
3 63.79±6.57 51.29±3.97★▼■ 43.18±2.71★▼■
3 60.63±6.81 40.73±2.28★■ 28.35±1.90★■
5 61.30±8.60 47.87±1.24★▼■ 41.41±1.88★▼■
6 54.05±5.96 53.01±6.41★▼ 49.89±1.07★▼
Table 4 Comparison of IUA in each group rats over time ($\bar{x}$±s, n=5, mmol/L)
Groups Liver Small Intestine
14 d 21 d 14 d 21 d
1 53.78±2.71 54.26±4.53 22.72±4.06 23.59±2.20
2 79.35±1.78 88.87±4.64 38.83±3.34 42.27±2.44
3 73.66±2.12★▼ 65.02±1.60★▼■ 30.26±2.27★▼ 28.65±1.11★▼■
4 65.98±1.58 56.04±1.01 25.83±1.82 24.58±1.22
5 67.02±1.48★▼ 60.36±1.11★▼■ 29.97±1.27★▼ 27.41±1.01★▼■
6 65.39±2.08★▼ 61.83±1.17★▼■ 29.52±1.13★▼ 27.52±1.23★▼■
Table 5 Comparison of XOD activity in liver and small intestine of each group rats over time ($\bar{x}$±s, n=5, U/g protein)
Groups Liver Small Intestine
14 d 21 d 14 d 21 d
1 1.21±0.009 1.26±0.011 1.13±0.002 1.28±0.054
2 1.82±0.005 1.85±0.008 1.65±0.000 1.61±0.238
3 1.49±0.009★▼ 1.23±0.011★▼■ 1.31±0.017★▼ 1.15±0.027★▼■
4 1.31±0.012 0.95±0.013★■ 1.09±0.000 0.90±0.000★■
5 1.40±0.015★▼ 1.13±0.006★▼■ 1.14±0.000★▼ 0.98±0.074★▼■
6 1.26±0.009★▼ 1.03±0.015★▼■ 1.12±0.000★▼ 0.93±0.000★▼■
Table 6 Comparison of relative gray value of XOD and GAPDH in liver and small intestine ($\bar{x}$±s, n=5)
Figure 1. The expression of XOD mRNA in liver of each on the 14th day after intervention of TD
Note: 1 Blank group; 2 Model group; 3 Low dose TD group; 4 moderate dose TD group; 5 High dose TD group; 6 Allopurinol group
Figure 2. The expression of XOD mRNA in liver of each group on the 21st day after intervention of TD
Note: 1 Blank group; 2 Model group; 3 Low dose TD group; 4 moderate dose TD group; 5 High dose TD group; 6 Allopurinol group
Figure 3. The expression of XOD mRNA in the small intestine of each group on the 14th day after intervention of TD
Note: 1 Blank group; 2 Model group; 3 Low dose TD group; 4 moderate dose TD group; 5 High dose TD group; 6 Allopurinol group
Figure 4. The expression of XOD mRNA in the small intestine of each group on the 21st day after intervention of TD
Note: 1 Blank group; 2 Model group; 3 Low dose TD group; 4 moderate dose TD group; 5 High dose TD group; 6 Allopurinol group
1.   Chang HY, Lee PH, Lei CC,et a1. Hyperuricemia Is an Independent Risk Factor for New Onset Micro-Albuminuria in a Middle-Aged and Elderly Population: A Prospective Cohort Study in Taiwan. PLoS One 2012, 8: e61450.2. LI HC, Wu HS.A new Urate-lowering drug-Febuxostat. Clin Med J 2012, 10: 52-55.3. Chen XM, Su YX.A brief understanding of gout ‘Bi syndrome caused by internal dampness.’ Fujian J Tradit Chin Med 2011, 42: 58-59.4. Su YX, Chen WH, Chen F,et a1. Effects of Tongfengning Granule on Blood Uric Acid, ESR, Blood Lipid and Blood Rheology in 30 Patients with Chronic Gouty Joints. Chinese J Tradi Med Trauma Orth 2005, 13: 18-20.5. Su YX, Chen WH, Chen F,et a1. Clinical Study on 30 Cases of Chronic Gouty Arthritis Treated by Tongfengning Granule. J Fujian Coll Tradit Chin Med 2003, 13: 12-14.6. Su YX, Lai Z, Zheng LP,et a1. Effects of Tongfengning Granule on the activity of serum xanthine oxidase in chicken gout model. Fujian J Tradi Chin Med 2006, 37: 41-42.7. Su YX, Liu XP, Zheng LP,et a1. Effects of Tongfengning Granule on uric acid metabolism in experimental mice with elevated blood uric acid. Fujian J Tradi Chin Med 2008, 39: 45-46.8. Su YX, Liu XP, Zheng LP,et a1. Effect of Tongfengning Granule on IL-1β and TNF-α in joint fluid of New Zealand rabbit gouty arthritis model induced by sodium urate. Fujian J Tradit Chin Med 2008, 39: 45-46.9. Du G, Jiang YT, Gu JR.Research progress on uric acid-lowering drugs. New Med 2017, 48: 369-374.10. Wu BC.Medical animal experiment foundation and basic technical methods. 1st ed.: People's Publishing House. Heilongjiang, Harbin, China 2008.11. Li J.Epidemiologic studies of hyperuricemia. Chinese J Cardiovasc Med 2016, 21: 83-86.12. Zhu CS, Zhang B, Li ZJ,et a1. Research progress of traditional Chinese medicine in the treatment of hyperuricemia. Tradi Chinese Med Pharm 2015:4374-4376.13. Yang HJ, Zhang L, Liu W,et a1. Advances in research on oral administration of traditional Chinese medicine for gout. Rheumatoid Arthritis 2017, 6: 67-71.14. Qin YW.Research progress on xanthine dehydrogenase. Forensic Med Sci 2002, 23: 218-219.15. Chen GL, Zhu LR, Na S,et a1. Effects of total saponins of saponins on chronic hyperuricemia and renal tubular uric acid transporter 1 expression in rats. Chin J Tradi Chin Med 2013, 38: 2348-2353.16. Guo SY, Zhang W, Zhang Y.Effect of Glabrous Greenbrier Rhizome on Uric Acid in Hyperuricemic Rats. Chin Pharm 2012, 21: 3-4.17. Wang JP, Liu YM, He ZC,et a1. Effect of ethanol extract of Alisma orientalis on hyperuricemia induced by potassium oxonate in rats. Chin Tradi Med 2017, 39: 605-608.18. Yao X, He SH, Tang Y,et a1. Extraction Separation and Pharmacodynamic Screening of Anti-gout Active Components from Lysinwchia christinae Hance. Mod Chin Med 2014, 16: 985-988.
[1] Man-Ke Guan, Jia-Yuan Hu, Xiao-Yu Zhang, Yang Sun, Hong-Cai Shang. Clinical research progress of ischemic heart failure and prospect of traditional Chinese medicine[J]. TMR Modern Herbal Medicine, 2019, 2(2): 115-120.
[2] Yu-hui Ma, Li-na Zhang, Qian Cui, Lin-feng Li, Guo-wei Zhang. Mechanism analysis of Traditional Chinese Medicine in treatment of Diabetic Nephropathy based on network pharmacology and Traditional Chinese Medicine inheritance support system[J]. TMR Modern Herbal Medicine, 2019, 2(2): 64-73.
[3] Jin Xiao-Ming, Cui Qian, Ma Yu-Hui, Gao Jing, Li Yuan. An introduction of the experience in treating Ventricular premature beat with stasis heat[J]. TMR Modern Herbal Medicine, 2019, 2(1): 19-24.
[4] Zhang Li-Hui, Zhao Yong-Chen. Systematic evaluation and Meta-analysis of acupuncture and collaterals cupping therapy for Knee Osteoarthritis[J]. TMR Modern Herbal Medicine, 2019, 2(1): 36-47.
[5] Kao Hsiu-Ying, Jiang Yong. Survey of dose-effect relationship in Chinese materia medica[J]. TMR Modern Herbal Medicine, 2018, 1(4): 249-258.
[6] Liu Xiao-Mei, Lv Hong, Wang Xiao-Ming, Guo Ya-Qing, Li Ting-Ting, Pan Gui-Xiang. Application of LC-MS based glutathione-trapped reactive metabolites in the discovery of toxicity of traditional Chinese medicine[J]. TMR Modern Herbal Medicine, 2018, 1(4): 209-219.
[7] Zhao Shao-Yang, Dong Xin, Tu Peng-Fei, Zeng Ke-Wu, Wang Xue-Mei. Neuroprotective Effect of Bu-Shen-Huo-Xue Extract against High Glucose-induced Apoptosis in PC12 Cells[J]. TMR Modern Herbal Medicine, 2018, 1(3): 143-154.
[8] Chen Qiang, Shang Hong-Cai, Han Bing-Kai, Jiao Jun. Perspectives in application of biosensors for the modernization of traditional Chinese medicine[J]. TMR Modern Herbal Medicine, 2018, 1(1): 39-46.