Please wait a minute...
1Traditional Medicine Research  2019, Vol. 4 Issue (6): 305-313    DOI: 10.12032/TMR20191024142
Special Issue on Endocrine and Metabolism     
Effects of Siwei Yuganzi decoction on LXRα and CYP7A1 in hyperlipidemic rats
Ru-Yi Yang1,*(), Hong-Bin Wang1, Pan-Pan Zhou2
1Department of Integrative Medicine, Affiliated Hospital of Qinghai University, Xining 810000, China
2Medical College of Qinghai University, Xining 810000, China.
Download: HTML     PDF(1045KB)
Export: BibTeX | EndNote (RIS)      

Highlights

A Tibetan (one of the ethnic minorities in China) compound preparation, Siwei Yuganzi decoction, can improve the serum levels of TC, TG, and LDL-C in the hyperlipidemic animal model via increasing the expression of both LXRα and CYP7A1 mRNA and proteins in the liver tissue.

Traditionality

Siwei Yuganzi decoction is an adaptation of a classical prescription of the Tibetan medicine called Sanguo decoction, which is recorded in the classic ancient book of Tibetan medicine entitled Sibu Jingdian, written by the famous Tibetan medical scientist named G.yuthog Rnyingma·Yontan Mgonpo in 800 C.E..

Abstract

Background: Hyperlipidemia (HLP) is a disorder in which lipids in the blood are disturbed due to abnormal lipid metabolism. Statins and fibrates lipid-regulating drugs prevent the generation of lipids and improves HLP, thereby reducing the likelihood of developing cardiovascular and cerebrovascular diseases. However, their adverse reactions and side effects limit a wide range of clinical applications. Tibetan medicine compound preparation Siwei Yuganzi decoction (SYD) is an adaptation of a classical prescription of the Tibetan medicine Sanguo decoction, that has been proved to have the effect of improving lipid metabolism; however, its possible mechanism remains unknown. Methods: Sixty specific-pathogen free grade Sprague Dawley rats were randomly divided into the blank control group, the HLP group, the Chinese patent medicine Xuezhikang positive control group, and the treatment groups with Tibetan SYD high-, middle-, and low-dosages respectively. Ten rats were assigned to each group. Every rat in these groups was fed with a high-fat emulsion to establish the hyperlipidemic animal model, except for those in the blank control group. Then the rats in the blank control and HLP groups were fed with 0.9% normal saline, those in Xuezhikang group were fed with Xuezhikang suspension at the dose of 0.11 g/kg/d, and those in SYD groups were fed with the SYD suspension at the dosage of 16.2 g/kg/d (high dosage), 10.8 g/kg/d (middle dosage), and 5.4 g/kg/d (low dosage), respectively. After 8 weeks, the levels of serum total cholesterol (TC), triglyceride (TG), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) were detected by the ELISA. The mRNA and protein expression levels of liver X receptor α (LXRα) and cholesterol 7α-hydroxylase 1 (CYP7A1) were detected using RT-PCR, western blotting, and immunohistochemistry. Results: The serum levels of TC, TG, and LDL-C in the HLP group were higher than those in the blank control group (P < 0.05), whereas the serum levels of HDL-C and the expression levels of both LXRα and CYP7A1 mRNA and proteins in the liver in the HLP group were lower than those in the control group (P < 0.05). After the treatment of the Xuezhikang and SYD, the serum levels of TG, TC, and LDL-C significantly decreased (P < 0.05), whereas the serum levels of HDL-C and the expression levels of both LXRα and CYP7A1 mRNA and proteins in the liver significantly increased compared with those in the HLP group (P < 0.05). Furthermore, The serum levels of TC, TG, and LDL-C in the SYD group at high dosage were lower (P < 0.05), the serum level of HDL-C was higher, and the expression levels of both LXRα and CYP7A1 mRNA and proteins in the liver tissue were higher than those in the Xuezhikang group (P < 0.05). Conclusion: SYD can improve the serum levels of TC, TG, and LDL-C in the hyperlipidemic animal model via increasing the expression of both LXRα and CYP7A1 mRNA and proteins in the liver tissue.



Key wordsHyperlipidemia      Experimental study      Tibetan medicine      Siwei Yuganzi decoction      LXRα      CYP7A1     
Published: 05 November 2019
Fund:  The study was supported by grant from the Science and Technology Department of Qinghai Province (NO. 2017-ZJ-737).
Corresponding Authors: Ru-Yi Yang   
E-mail: 1072736190@qq.com
Cite this article:

Ru-Yi Yang, Hong-Bin Wang, Pan-Pan Zhou. Effects of Siwei Yuganzi decoction on LXRα and CYP7A1 in hyperlipidemic rats. 1Traditional Medicine Research, 2019, 4(6): 305-313. doi: 10.12032/TMR20191024142

URL:

https://www.tmrjournals.com/tmr/EN/10.12032/TMR20191024142

Primer name Sequence Tm value (℃) Product size (bp)
β-actin-F GGAGAAGATTTGGCACCACAC 59.46 173
β-actin-R ACACAGCCTGGATGGCTACG 62.24
LXRα-F GAGGGCTGCAAGGGATTCTT 60.03 128
LXRα-R CATTTGCGAAGGCGACACTC 60.18
CYP7A1-F TGGAAGACTCTTTGCCGTCC 59.97 101
CYP7A1-R GAGGGGGACACTTGACTTGG 59.96
Table 1 Designed primer sequences and analysis conditions
Groups n TC
(mmol/L)
TG
(mmol/L)
LDL-C
(mmol/L)
HDL-C
(mmol/L)
Blank control 10 5.98 ± 0.40 4.32 ± 0.36 2.33 ± 0.35 4.84 ± 0.45
HLP 10 7.10 ± 0.25 a 6.68 ± 0.60 a 4.18 ± 1.30 a 2.32 ± 0.49 a
Xuezhikang 10 6.51 ± 0.32 b 5.34 ± 0.39 b 3.08 ± 0.42 b 4.01 ± 0.45 b
SYD high dosage 10 5.80 ± 0.23 bc 4.70 ± 0.46 bc 2.56 ± 0.45 bc 4.58 ± 0.28 bc
SYD middle dosage 10 6.14 ± 0.20 bd 5.40 ± 0.31 bd 2.93 ± 0.33 bd 3.89 ± 0.30 bd
SYD low dosage 10 6.56 ± 0.32 bd 5.70 ± 0.41 bd 3.28 ± 0.32 bd 3.59 ± 0.08 bd
P < 0.001 < 0.001 < 0.001 < 0.001
Table 2 Effect of SYD on lipid metabolism in experimental hyperlipidemic rats ($\bar{x}$± s)
Groups n LXRα CYP7A1
Blank control 6 1.44 ± 0.07 2.51 ± 0.35
HLP 6 1.11 ± 0.16 a 1.26 ± 0.23 a
Xuezhikang 6 1.32 ± 0.05 b 1.72 ± 0.23 b
SYD high dosage 6 1.40 ± 0.05 bc 2.31 ± 0.30 bc
SYD middle dosage 6 1.31 ± 0.01 bd 2.00 ± 0.13 bcd
SYD low dosage 6 1.29 ± 0.01 bd 1.55 ± 0.22 bd
P < 0.001 < 0.001
Table 3 Effect of SYD on LXRα and CYP7A1 mRNA expression levels in rat liver tissues ($\bar{x}$± s)
Figure 1 Western blotting results of LXRα and CYP7A1 protein in rat liver tissues

LXRα, Liver X receptor α; CYP7A1, Cholesterol 7α-hydroxylase 1; HLP, Hyperlipidemia; SYD, Siwei Yuganzi decoction.

Groups n LXRα CYP7A1
Blank control 6 0.99 ± 0.15 0.86 ± 0.12
HLP 6 0.23 ± 0.11 a 0.17 ± 0.06 a
Xuezhikang 6 0.51 ± 0.13 b 0.43 ± 0.09 b
SYD high dosage 6 0.84 ± 0.14 bc 0.61 ± 0.15 bc
SYD middle dosage 6 0.53 ± 0.09 bd 0.44 ± 0.07 bd
SYD low dosage 6 0.44 ± 0.12 bd 0.31 ± 0.08 bd
P < 0.001 < 0.001
Table 4 Comparison of mean gray values of LXRα and CYP7A1 protein in rat liver ($\bar{x}$± s)
Figure 2 Immunohistochemical expression of LXRα in rat liver and immunohistochemical expression of CYP7A1 in rat liver

LXRα, Liver X receptor α; CYP7A1, Cholesterol 7α-hydroxylase 1; HLP, Hyperlipidemia; SYD, Siwei Yuganzi decoction.

Groups n LXRα CYP7A1
Blank control 6 48.12 ± 3.18 38.25 ± 2.59
HLP 6 34.53 ± 2.45 a 24.15 ± 1.78 a
Xuezhikang 6 40.38 ± 1.59 b 34.18 ± 2.57 b
SYD high dosage 6 44.38 ± 2.41 bc 37.57 ± 1.36 bc
SYD middle dosage 6 41.19 ± 2.47 bd 33.45 ± 2.18 bd
SYD low dosage 6 38.32 ± 1.58 bd 31.19 ± 2.49 bd
P < 0.001 < 0.001
Table 5 Effect of SY decoction on LXRα and CYP7A1 in the liver tissue of rats with experimental HLP ($\bar{x}$ ± s)
1.   Go GW, Mani A. Low-density lipoprotein receptor (LDLR) family orchestrates cholesterol homeostasis. Yale J Bio Med 2012, 85: 19-28.
2.   Bao L, Borjihan G. Hyoolipidemic effects of piperlonguminine in HepG2 cells and in Wistar rats. Pharmazie 2012, 67: 858-861.
3.   Yang W, Xiao J, Yang Z, et al. Serum lipids and lipoproteins in Chinese men and women. Circulation 2012, 125: 2212-2221.
4.   Liu YC. Compound danshen dropping pill combined calcium rui shu cut statin treatment of coronary heart disease (CHD) combined hyperlipidemia clinical curative effect analysis. Chin Pract Med 2014, 9: 183-184. (Chinese)
5.   Soslow RA, Dannenberg AJ, Rush D, et al. Cox-2 is expressed in human pulmonary, colonic, and mammary tumors. Cancer 2000, 89: 2637-2645.
6.   Liu ML. Classification, Uses, and Main Side Effects of Commonly Used Lipid-modifying Drugs (Continued 3). Chin Circul J 2010, 25: 36-70. (Chinese)
7.   Jiang H, Shi Y, Zhao SY, et al. Analysis of Spectrumeffect Relationship of Antioxidant Activity of Sanguotang Based on Partial Least Square Method. Chin J Exp Tradit Med Formulae 2018, 24: 8-12. (Chinese)
8.   Qi Q, Cui YP, Liang WY, et al. The Phytochemical The Phytochemical and Pharmacological Progress on Comparisons Between Terminalia Chebula Retz. and Terminalia Chebula Retz. in Tibetan Medicine. World Sci Technol Modern Tradit Chin Med Mater Med 2016, 18: 1171-1176. (Chinese)
9.   Pasang-Dekyi, Kunpo, Sonam, et al. A Summary of the Study on the Modification of Zhe Bu Song Decoction. Tibet Sci Technol A Summary of the Study on the Modification of Zhe Bu Song Decoction. Tibet Sci Technol 2018: 45-46. (Chinese)
10.   De L, Yao Z, Ji J, et al. Preliminary Study for Antioxidant Components of Tibetan Medicine Sanguo Tang San by TLC-bioautograhpy Preliminary Study for Antioxidant Components of Tibetan Medicine Sanguo Tang San by TLC-bioautograhpy and HPLC Fingerprinting. Chin J Exp Tradit Med Formulae 2012, 18: 98-102. (Chinese)
11.   Wang LY, Wang DQ, Qing YW, et al. Effect of emblic lesfflower fruit on total antioxidation and levels of malondialdehyde as well as endothelin in plasma in rabbits with atherosclerosis. Chin J Tissue Eng Res 2005, 9: 253-256.
12.   Banjare J, Raina P, Mansara P, et al. Triphala, regulates adipogenesis through modulation of expression of adipogenic genes in 3T3-L1 cell line. Pharmacogn Mag 2018, 13: S834-S839.
13.   Zhao JM, Zhu JH, Chen H, et al. Study on Hyperlipemia Model of Guinea Pig with Different Formulations of High Fat Emulsion. Pharm Clin Chin Mater Med Study on Hyperlipemia Model of Guinea Pig with Different Formulations of High Fat Emulsion. Pharm Clin Chin Mater Med 2012, 28: 177. (Chinese)
14.   Sun Q, Wang SE, Fu SQ, et al. Effect of soybean peptide on blood lipid in experimental hyperlipidemia rats Effect of soybean peptide on blood lipid in experimental hyperlipidemia rats and its mechanism. Chin J Gerontol 2014, 34: 2169-2171. (Chinese)
15.   Shen Q, Zhang HJ, Yang MH, et al. Study on the Effect Study on the Effect and Mechanism of Xuezhiping Capsule on Blood Lipid Levels of High Blood Lipid Model Golden Hamsters. J China Pharm 2017, 28: 2212-2215. (Chinese)
16.   Xu BP, Cheng YL, Lu X, et al. The effects of Xue Zhi Kang on mouse macrophage cells uptake oxidized Low density Lipoprotein. Jiangsu J Prev Med 2004, 15: 9-10. (Chinese)
17.   Wang F, Zhu C. Effect of Xuezhikang on C-reactive Protein in Patients with Dyslipidemia. Guangzhou Med J 2002, 33: 23-33. (Chinese)
18.   Wu DM, Pan T, Shi GF. Effect of Xuezhikang on adiponectin, leptin and atherosclerosis in hyperlipidemia rats. Chin J Integr Med Cardio-Cerebrovascul Dis 2011, 9: 969-971. (Chinese)
19.   Zhu QJ, Zheng GJ, Zhang WG, et al. Effects of Xuezhikang on Ca2+ and Mitochondrial Membrane Potential in Hepatocytes of Apolipoprotein E Gene-Knock Out Mice. Chin J Arteriosclerosis 2006, 14: 97-99. (Chinese)
20.   Martel C, Li W, Fulp B, et al. Lymphatic vasculature mediates macrophage reverse cholesterol transport in mice. J Clin Invest 2013, 123: 1571-1579.
21.   Zhao C, Dahlman-Wright K. Liver X receptor in cholesterol metabolism. J Endocrinol 2009, 204: 233-240.
22.   Collins JL, Fivush AM, Watson MA, et al. Identifcation of a nonsteroidal liver X receptor agonist through parallel array synthesis of tertiary amines. J Med Chem 2002, 45: 1963-1966.
23.   Ma N, Wang QH, Chen C, et al. Black rice regulated cholesterol by up-regulation CYP7A1 expression. Chin Food Addit 2015, 9: 66-71. (Chinese)
24.   Hiroaki O. Functions of sulfur-containing amino acids in lipid metabolism. J Nutr 2006, 136: 1666S-1669S.
25.   WANG Yanan, ZHANG Jiahong, GUO Haitao, et al. Combined Effect of Methionine Restriction and Collagen Peptides on Lipid Metabolism and Oxidative Stress in High-Fat Diet-Fed Mice. Food Sci 2018, 39(9): 108-115. (Chinese)
26.   Chen YL, Wang XQ, Wang YW, et al. Effect and Mechanism of Pigments from Pu-erh Tea on Lipid Metabolism in HepG2 Cell Model. Food Sci 2017, 38: 203-209. (Chinese)
[1] Jun-Jie Zhang, Xian-Zhi He, Guo-Shun Peng, Zhen-Kun Wang, Bin Ke, Jian Qin. Effect of alternate-day-fasting combined with Lingguizhugan Decoction on blood lipid profiles of hyperlipidemic rats[J]. 1Traditional Medicine Research, 2018, 3(3): 157-165.